STR chr1:55039870-55039905

Motif GCC repeats 12 times in the reference sequence.


...CACCGCAAGGCTCAAGGCGCCGCCGGCGTGGACCGCGCACGGCCTCTAGGTCTCCTCGCCAGGACAGCAACCTCTCCCCTGGCCCTCATGGGCACCGTCA
GCTCCAGGCGGTCCTGGTGGGCCGCTGCCACTGCTGCTGCTGCTGCTGCTGCTCCTGGGTCCCGCGGGCGCCCGTGCGCAGGAGGACGAGGACGGCGACT
ACGAGGAGCTGGTGCTAGCCTTGCGTTCCGAGGAGGACGGCCTGGCCGAAGCACCCGAGCACGGAACCACAGCCAC...


Maps to PCSK9, proprotein convertase subtilisin/kexin type 9

No data on allele frequencies in healthy genomes available.



ParameterValue
Total calls 13
Fraction variable 0.000
Average length difference 0.000
See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


No Data Available.

See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.