STR chr1:55034612-55034619

Motif TA repeats 4 times in the reference sequence.


...CAGCCTATTTTACAATTTTAAACATGATATAACTGTAGAATGCAGACATCAAGACTCTCTTATAATTCCATTTGGGGTCTGTACCTTAAATCTTATGTTG
TTTATGCAGAGACAAACATTTATATATACAAATGTAACCACTTTATTGAAATGGGATCATAACATGCTGTTTAAAAGTTATTGATGTTGGACATCTTTCC
ATGTCAATATATAAACCTCCATTTATTTCTTTTTACCAGCTGCCAAAT...


Maps to PCSK9, proprotein convertase subtilisin/kexin type 9

No data on allele frequencies in healthy genomes available.



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


No Data Available.

See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.