STR chr22:46617974-46617984

Motif A repeats 11 times in the reference sequence.


...TCCCAGCTACTTGGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGGAGCTGGAGGTTGCAGTGAGCTGAGATCGCACCACTGCACTCCAGCTTGGGCAA
CAGAGTGAGACTCTGTCTCA
AAAAAAAAAAGAAAGGAAAAGAAAGGACCACTTGTTATAGAAAGCCTGTCTTTTAAGGTAGCTCTGGACCTTTTCAGAGG
CAGCCAAATTGCCCCTCATGGTTCGTCCCCCACATCCCCGCCTGCCTGGC
...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 3.47e-06
Mutation model: Beta 0.760
Mutation model: P(single step) 1.000
Constraint (Z-score) 0.000
Stutter model: up 0.007
Stutter model: down 0.008
Stutter model: p 0.945
See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.