STR chr22:46621928-46621939

Motif AC repeats 6 times in the reference sequence.


...TACACACACACATGCATGCTCACACACATGCACCCAGGCACACACAAATCCACATTCACCCATACAGTCACACACATGCATACACACACATACAAACACA
TGCATTCACACAGATGCATACACACACACACTTACAAACTACACATGTGCTTATACATGCTCACATGCATGTATATGCACACACATACCCTCACCTTATG
CACACATGTACCCACACACGTACCCACACATATACAAGCATGCACACATAT...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 2.40e-08
Mutation model: Beta 0.046
Mutation model: P(single step) 0.852
Constraint (Z-score) 0.000
Stutter model: up 0.000
Stutter model: down 0.002
Stutter model: p 0.929
See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.